bangladesh torist Videos - HiFiMov.co

HiFiMov

Did you mean?

Search Results - Showing 0 - 12 Of 77

This is the shocking moment a fighter jet bounced off a runway before the pilot ejected and died.Squadron leader Asim Jawad, 32, appeared to be attempting Top Gun style three aileron rolls at low altitude when the fuselage of the Yakovlev Yak-130 scraped along the tarmac. CCTV shows smoke and sparks erupting from the Russian-made jet before Asim pulled up and appeared to be circling the runway in Chattogram, Bangladesh, on May 9.However, the footage shows a sudden explosion before Bangladesh Air Force pilot Asim and his co-pilot Wing Commander Sohan Hasan Khan both ejected.Local media reported that the two pilots both landed in the Karnaphuli River before being rescued by members of the air force, navy and local fishermen.Asim later died in hospital while Sohan remains in critical condition at the Banouja Isa Khan Hospital in Patenga. The aircraft was later recovered from the water.The government's Inter-Services Public Relations (ISPR) said in a statement that the training jet had 'crashed due to a mechanical failure'.They claimed the pilots manoeuvred the aircraft away from the densely populated area near the airport to the sparsely populated area where they crashed.However, CCTV footage of the incident appears to show the crash was caused by the high-risk stunt.A source said: 'The Bangladesh Air Force claimed the crashed YAK 130 fighter jet encountered mechanical failure, resulting in a catastrophic crash in the Patenga area of Chittagong. However, recently obtained CCTV footage from the runway area contradicts this claim by BAF, displaying a chilling sequence where the aircraft attempts to perform three consecutive aileron rolls at a perilously low altitude, nearly colliding with the runway in the process.'The footage reveals the jet scraping the runway at high speed, causing significant damage to the fuselage and igniting a fire. At the 19-second mark, a slowed-down analysis shows fragments of the aircraft detaching as it rebounds and gets airborne.'In the critical moments that followed, as captured in the video, the engine became engulfed in flames, emitting black smoke. The two pilots, demonstrating exceptional skill under pressure, managed to eject from the flaming jet. The ejection, a procedure known to exert enormous g-force on the body, often results in temporary loss of consciousness.'

Pilot dies after attempting high-risk ‘Top Gun’ stunt in fighter jet

⏲ 2:59 👁 18.6M

Joyous Travel

Amazing Places to Visit in Bangladesh - Travel Video

⏲ 10 minutes 1 second 👁 292.8K

Kurt Caz

Extreme Tourism in Bangladesh! 🇧🇩

⏲ 40 minutes 7 seconds 👁 429.2K

The Immigration Department has busted the operations of a syndicate involved in falsifying passports over the past two years in a house in Kajang.<br/><br/>Its director-general Datuk Ruslin Jusoh said a 38-year-old Bangladeshi mastermind, known as ‘Ofu Bhai’ was arrested along with his 40-year-old Filipina partner.<br/><br/>Read more at https://tinyurl.com/2jdx48j9<br/><br/>WATCH MORE: https://thestartv.com/c/news<br/>SUBSCRIBE: https://cutt.ly/TheStar<br/>LIKE: https://fb.com/TheStarOnline

Fake passport syndicate busted, two nabbed in Kajang

⏲ 2:19 👁 10.9M

Before You Go

Bangladesh Tourist Places: 11 Places to Visit in Bangladesh (Travel Guide)

⏲ 9 minutes 27 seconds 👁 8.8K

Counting Countries

I Traveled to the World's Most Crowded City (Dhaka, Bangladesh)

⏲ 14 minutes 28 seconds 👁 215.4K

Indulge in the sweet, crispy goodness of our homemade Jilapi! Made with a blend of flour, sugar, and aromatic spices, these golden treats are perfect for satisfying your sweet cravings. Whether as a delightful snack or a festive treat, our Jilapi recipe is sure to delight your taste buds! ✨

Jilapi | ১ কাপ ময়দা দিয়ে মুচমুচে রসালো রেশমি জিলাপী | The Easiest Sweet Jilapi Recipe Anyone Can Make | Crispy Jalebi

⏲ 5:56 👁 40K

Jason Billam Travel

Why Dhaka (Bangladesh) is More Modern Than You Think 🇧🇩

⏲ 12 minutes 51 seconds 👁 177.4K

Public Times

Gopalganj News: 15 May 2024 गोपालगंज न्यूज़ | Public Times। Khas khabar। Uptodate।

⏲ 13 minutes 51 seconds 👁 169

BilyBazaar is one of the largest and most popular online marketplaces in Bangladesh. It offers a wide range of products, including electronics, fashion, beauty, home essentials and many more!..<br/><br/><br/>

শাড়ীতে, খুব অ-সাধারন সুন্দর লাগছে কৌশানী মোখার্জীকে...

⏲ 0:18 👁 30K

DN Eyes

তাজা ইলিশ ধরতে গিয়ে কি হলো দেখুন || Live Hilsha Fish catching | DN Eyes | Sundarban fishing

⏲ 23 minutes 39 seconds 👁 2.6M

Ilya Varlamov

Bangladesh: People Struggling to Survive in the Most Overpopulated Country in the World

⏲ 1 hour 38 minutes 26 seconds 👁 844.8K

Pages 1 Of 7

...

...

Related Searches

Search Videos

Recent Searches

crish gail | 22 gejzasuc | dev and srab | orders enguage2excel com | iw email | ভিডিও দেখব | technic lego cars | galatians 3 1 kjv | ভীডিও গান | বাবার দোন দরা মেয়ে গুমের ঘরে | رومکس بشمار تتلو | griot definition world history | bangla new mp3 rimes song baul gan dhakawap co | freedom sales florida | pm et tr1 | sunny leone big hot sunny leone latest hd বিশ্ | ভুতের বয়ানক কাহিনী | woman gla চুপড়া | میسترس ابتو بریز | men amv | tetris effect mods | bangla desimagi | mera nam meri hi | students with teachers | digilocker cbse | www xnxvideos com 3gp angla | multirenders 424 | tere ishq ke naam epi 5 | একছ একছ ডাবলু ডাবলু ডট কম | pasan movie hd | neymarbest skill ever | new boby photos | rang se1 love in canada | spb insurance | ছোট ছেলে মেয়েদের vid | ke cell amai bolo na tume tv ad ringtone mp | bad alien | speargun line | www bangladesh play | jubin nautiyal bhajan | diamond dialysis sugarland | shakira video | fire music film | x8q3337 | hangouts downloaden | amar ato dukko audio song | colt dekha hololink bonita thakle jitbe sublime | hifi snaps পিকচার | net 24 bd com | ggcaccatcatcaagcccaag | ghanaian movies | سکس 😝 | bangla video songs mon laptop | crime petrol sony bangla chotidian | certificate | we real fights | yankees mlb stream | game ready driver or studio driver reddit | baseball card generator | chase championship java game best mission action wave | বাংলাদেশি কলেজ গাল কে জোর করে চ ভিডিও | latest ringtone | wife cheat | gax | titans go coloring pages as pj masks | lspdfr jeff favignano | princess tyra | bangla updat | www bangla naika oppu bi | শিরিনার | virat koholi | devi hindi | jonaki gay fisk fish rumi mp nokia major jodi sobi | bangla video 3gani na jani | box ja | seems to me | free online image downloader | dil to pagal hai hindi song | anne hagen | pm karachi bas robot | vdm231890013 | à¦…à¦ªà¦°à¦¾à¦§à§€ à¦®à¦¾ à¦—à¦œà¦² | မြန်မာဖူးကား | klavaro download windows 10 | lucia | sirf tum kavita se likhe | llp loss on taxes | ipl match | mor band | sajatnur songs video | song champagne | nida hot | szarlotka z kruszonka magdy gessler | নাইকা কোয়েলের ছবিোদাচুদি মেয়েদের ছোদাছদি |